Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Tcf/Lef:H2B-GFP
(Plasmid #32610)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 32610 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone size w/o insert (bp) 4700
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Tcf/Lef:H2B-GFP
  • Promoter hsp68

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AseI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer GF PGenotFW: A CAACAAGCGCTCGACCATCAC;
  • 3′ sequencing primer GFPGenotRW: AGTCGATGCCCTTCAGCTCGAT
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

To g ene r a t e t h e p T CF /L e f :H 2 B -GFP co n s t ru c t , s i x
copies of the TCF/Lef response elements together with
the hsp68 minimal promoter from the TCF/Lef-LacZ
reporter construct [11] were inserted into the AseI/Nhe1
sites of pCMV::H2B-GFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tcf/Lef:H2B-GFP was a gift from Anna-Katerina Hadjantonakis (Addgene plasmid # 32610 ; http://n2t.net/addgene:32610 ; RRID:Addgene_32610)
  • For your References section:

    A sensitive and bright single-cell resolution live imaging reporter of Wnt/ss-catenin signaling in the mouse. Ferrer-Vaquer A, Piliszek A, Tian G, Aho RJ, Dufort D, Hadjantonakis AK. BMC Dev Biol. 2010 Dec 21;10:121. 10.1186/1471-213X-10-121 PubMed 21176145