Skip to main content
Addgene
Open Menu

pCAG-Izumo1-1D4
(Plasmid #183544)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183544 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 183544-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 183544-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5200
  • Total vector size (bp) 6391
  • Modifications to backbone
    pCAGGS was used as an original vector. 1D4 sequence was added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    izumo sperm-egg fusion 1
  • Alt name
    Izumo1
  • Alt name
    1700058F15Rik
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1191
  • Entrez Gene
    Izumo1 (a.k.a. 1700058F15Rik, Izumo)
  • Tag / Fusion Protein
    • 1D4

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Izumo1-1D4 was a gift from Masahito Ikawa (Addgene plasmid # 183544 ; http://n2t.net/addgene:183544 ; RRID:Addgene_183544)

  • For your References section:

    Sperm membrane proteins DCST1 and DCST2 are required for sperm-egg interaction in mice and fish. Noda T, Blaha A, Fujihara Y, Gert KR, Emori C, Deneke VE, Oura S, Panser K, Lu Y, Berent S, Kodani M, Cabrera-Quio LE, Pauli A, Ikawa M. Commun Biol. 2022 Apr 7;5(1):332. doi: 10.1038/s42003-022-03289-w. 10.1038/s42003-022-03289-w PubMed 35393517
Related items:
Commonly requested with: