Skip to main content

Ki67 (LR)-mNeonGreen-IRESpuro2
(Plasmid #183743)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 183743 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 183743-D50 50 μg of DNA in Tris buffer $495
DNA 183743-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRESpuro2
  • Backbone size w/o insert (bp) 5091
  • Total vector size (bp) 6792
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MKI67 LR domain
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1701
  • Mutation
    LR domain of Ki67
  • Entrez Gene
    MKI67 (a.k.a. KIA, MIB-, MIB-1, PPP1R105)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BstBI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CAGAGCTGGTTTAGTGAACC
  • 3′ sequencing primer ATTCCAGCACACTGGATCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Ki67 (LR)-mNeonGreen-IRESpuro2 was a gift from Daniel Gerlich (Addgene plasmid # 183743 ; http://n2t.net/addgene:183743 ; RRID:Addgene_183743)
  • For your References section:

    Ki-67 acts as a biological surfactant to disperse mitotic chromosomes. Cuylen S, Blaukopf C, Politi AZ, Muller-Reichert T, Neumann B, Poser I, Ellenberg J, Hyman AA, Gerlich DW. Nature. 2016 Jun 29;535(7611):308-12. doi: 10.1038/nature18610. 10.1038/nature18610 PubMed 27362226