pODN-mR2-MYH10
(Plasmid
#183869)
-
PurposeRepair template for the N-terminal tagging of myosin heavy chain 10 with mRuby2 in human cells using CRISPR/Cas9.
-
Depositing Lab
-
Depositing OrganizationConcordia University
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 183869 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 183869-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 183869-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepJET1.2
-
Backbone manufacturerThermo Fischer Scientific
- Backbone size w/o insert (bp) 2974
- Total vector size (bp) 5719
-
Vector typeMammalian Expression, CRISPR ; Donor template
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMYH10 homology arms with mRuby2-linker
-
Alt nameMyosin heavy chain 10
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2745
-
MutationHomology arms contain point mutations to remove the sgRNA target site
-
Entrez GeneMYH10 (a.k.a. NMMHC-IIB, NMMHCB)
-
Tag
/ Fusion Protein
- mRuby2-linker (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAACTGCTTTAACACTTGTGCCTG
- 3′ sequencing primer GTTCCTGATGAGGTGGTTAGCATAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 183869-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 183869-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pODN-mR2-MYH10 was a gift from Alisa Piekny (Addgene plasmid # 183869 ; http://n2t.net/addgene:183869 ; RRID:Addgene_183869) -
For your References section:
Cytokinetic diversity in mammalian cells is revealed by the characterization of endogenous anillin, Ect2 and RhoA. Husser MC, Ozugergin I, Resta T, Martin VJJ, Piekny AJ. Open Biol. 2022 Nov;12(11):220247. doi: 10.1098/rsob.220247. Epub 2022 Nov 23. 10.1098/rsob.220247 PubMed 36416720