H2B-GFP-Aurora B WT
(Plasmid
#184042)
-
PurposeExpresses H2B-GFP fused to Aurora B WT
-
Depositing Lab
-
Depositing OrganizationJustus Liebig-Universitaet Giessen
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 184042-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 184042-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneH2B-EGFP
- Backbone size w/o insert (bp) 5111
- Total vector size (bp) 6078
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAURKB
-
Alt nameAurora B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)954
-
GenBank IDNM_001256834.3
-
Entrez GeneAURKB (a.k.a. AIK2, AIM-1, AIM1, ARK-2, ARK2, AurB, IPL1, PPP1R48, STK-1, STK12, STK5, aurkb-sv1, aurkb-sv2)
- Promoter CMV
-
Tags
/ Fusion Proteins
- H2B (N terminal on backbone)
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn2I (not destroyed)
- 3′ cloning site ApaI (not destroyed)
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer CCTCTACAAATGTGGTATGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 184042-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 184042-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H2B-GFP-Aurora B WT was a gift from Lienhard Schmitz (Addgene plasmid # 184042 ; http://n2t.net/addgene:184042 ; RRID:Addgene_184042) -
For your References section:
The Aurora B-controlled PP1/RepoMan complex determines the spatial and temporal distribution of mitotic H2B S6 phosphorylation. Pfisterer M, Robert R, Saul VV, Pritz A, Seibert M, Feederle R, Schmitz ML. Open Biol. 2024 May;14(5):230460. doi: 10.1098/rsob.230460. Epub 2024 May 29. 10.1098/rsob.230460 PubMed 38806145
