Skip to main content

scFv-GCN4-sfGFP-deadTET1CD
(Plasmid #184442)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 184442 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pHR
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Catalytically DEAD TET1

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tactttaatggctgtaagtttggtagaag
  • 3′ sequencing primer gccatcagcagcagctgcattg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    scFv-GCN4-sfGFP-deadTET1CD was a gift from Rhys Allan (Addgene plasmid # 184442 ; http://n2t.net/addgene:184442 ; RRID:Addgene_184442)
  • For your References section:

    Activation of stably silenced genes by recruitment of a synthetic de-methylating module. Chan WF, Coughlan HD, Chen Y, Keenan CR, Smyth GK, Perkins AC, Johanson TM, Allan RS. Nat Commun. 2022 Sep 23;13(1):5582. doi: 10.1038/s41467-022-33181-4. 10.1038/s41467-022-33181-4 PubMed 36151095