MS2-p65-HSF1-P2A-mCherry
(Plasmid
#184440)
-
PurposeMS2 coat protein fused with p65 and hsf1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 184440 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMS2-p65-hsf1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer gaatagagttaggcagggatattc
- 3′ sequencing primer attgagggccgaagggacgtagcag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Read the preprint at bioRxiv: https://www.biorxiv.org/content/10.1101/2021.09.11.459888v1.full
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MS2-p65-HSF1-P2A-mCherry was a gift from Rhys Allan (Addgene plasmid # 184440 ; http://n2t.net/addgene:184440 ; RRID:Addgene_184440) -
For your References section:
Activation of stably silenced genes by recruitment of a synthetic de-methylating module. Chan WF, Coughlan HD, Chen Y, Keenan CR, Smyth GK, Perkins AC, Johanson TM, Allan RS. Nat Commun. 2022 Sep 23;13(1):5582. doi: 10.1038/s41467-022-33181-4. 10.1038/s41467-022-33181-4 PubMed 36151095
Map uploaded by the depositor.
