pUPD2_SulR(CDS)
(Plasmid #186423)

• Purpose: provides sulfadiazine resistance (sulI) as a level 0 GoldenBraid part (CDS; B3-B4-B5)
• Depositing Lab: Lukas Fischer
• Publication: Kobercova et al Plant Cell Rep. 2023 Jan 7. doi: 10.1007/s00299-022-02975-7.

Backbone

• Vector backbone: pUPD2
• Backbone manufacturer: GoldenBraid kit from Diego Orzaez (Addgene kit # 1000000076 ), IBMCP, Valencia, Spain
• Backbone size w/o insert (bp): 2106
• Total vector size (bp): 3117
• Vector type: Plant Expression, Synthetic Biology ; CDS (part B3-B4-B5), GoldenBraid level 0

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SulR
• Alt name: sulfadiazine resistance
• Alt name: sulI
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 1011
• Mutation: BsaI and BsmBI sites removed

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: pUDP2_F: GCTTTCGCTAAGGATGATTTCTGG
• 3′ sequencing primer: pUDP2_R: CAGGGTGGTGACACCTTGCC

Resource Information

• Supplemental Documents:
  • pUPD2_SulR(CDS).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry