Cas9_YTHDF2_sgRNA
(Plasmid
#186673)
-
PurposeYTHDF2 sgRNA plasmid
-
Depositing Lab
-
Depositing OrganizationNational Institute of Diabetes & Digestive & Kidney Diseases (NIDDK)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186673 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186673-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186673-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepL-CRISPR.EFS.GFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYTHDF2 KO sgRNA Plasmid
-
gRNA/shRNA sequenceGACGAGGCCCGCCGAGAGAA
-
SpeciesH. sapiens (human)
-
Entrez GeneYTHDF2 (a.k.a. CAHL, DF2, HGRG8, NY-REN-2)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sgRNA sequence: GAACGCGGCAGACGCGCCAC. The corresponding genome sequence is: AAACGCGGCAGACGCGCCAC.
Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint.
DNA (Catalog # 186673-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186673-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cas9_YTHDF2_sgRNA was a gift from Astrid Haase (Addgene plasmid # 186673 ; http://n2t.net/addgene:186673 ; RRID:Addgene_186673) -
For your References section:
Functional editing of endogenous genes through rapid selection of cell pools (Rapid generation of endogenously tagged genes in Drosophila ovarian somatic sheath cells). Meng Q, Stoyko D, Andrews CM, Konstantinidou P, Genzor P, O T, Elchert AR, Benner L, Sobti S, Katz EY, Haase AD. Nucleic Acids Res. 2022 May 27. pii: 6594084. doi: 10.1093/nar/gkac448. 10.1093/nar/gkac448 PubMed 35639929