pGAPDH::H2B-mScarlet
(Plasmid
#186764)
-
PurposeA plasmid containing planarian H2B fused to a planarian codon-optimized mScarlet, driven by the planarian GAPDH promoter.
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 186764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 186764-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 186764-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDEST-R4-R3
-
Backbone manufacturerThermoFisher
- Backbone size w/o insert (bp) 6727
- Total vector size (bp) 7801
-
Vector typeOverexpression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-mScarlet
-
SpeciesSchmidtea mediterranea
-
Insert Size (bp)1073
- Promoter GAPDH
-
Tag
/ Fusion Protein
- H2B
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer TGTAAAACGACGGCCAGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 186764-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 186764-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGAPDH::H2B-mScarlet was a gift from Bo Wang (Addgene plasmid # 186764 ; http://n2t.net/addgene:186764 ; RRID:Addgene_186764) -
For your References section:
Heterologous reporter expression in the planarian Schmidtea mediterranea through somatic mRNA transfection. Hall RN, Weill U, Drees L, Leal-Ortiz S, Li H, Khariton M, Chai C, Xue Y, Rosental B, Quake SR, Sanchez Alvarado A, Melosh NA, Fire AZ, Rink JC, Wang B. Cell Rep Methods. 2022 Sep 20;2(10):100298. doi: 10.1016/j.crmeth.2022.100298. eCollection 2022 Oct 24. 10.1016/j.crmeth.2022.100298 PubMed 36313809
