pX330-PolB-gRNA-14-3-hspCas9
(Plasmid
#187199)
-
PurposegRNA-3 to target PolB exon 14.
-
Depositing Lab
-
Depositing OrganizationUniversity of South Alabama, Mitchell Cancer Institute
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerAddgene
- Total vector size (bp) 8506
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namePolB-gRNA insert
-
gRNA/shRNA sequencePolB exon 14-3
-
SpeciesH. sapiens (human)
- Promoter U6
-
Tag
/ Fusion Protein
- N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
- 5′ sequencing primer ggactatcatatgcttaccgtaac
- 3′ sequencing primer ccatttgtctgcagaattggc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-PolB-gRNA-14-3-hspCas9 was a gift from Robert Sobol (Addgene plasmid # 187199 ; http://n2t.net/addgene:187199 ; RRID:Addgene_187199) -
For your References section:
Ubiquitylation of DNA polymerase beta via atypical K27 chains signals a DNA damage response. Fang Q, Koczor CA, Roos WP, McClellan S, Andrews JF, Sobol RW. Nucleic Acids Res. 2026 Apr 13;54(7):gkag344. doi: 10.1093/nar/gkag344. 10.1093/nar/gkag344 PubMed 41978267