Skip to main content

pX330-PolB-gRNA-14-4-hspCas9
(Plasmid #187206)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 187206 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pX330
  • Backbone manufacturer
    Addgene
  • Total vector size (bp) 8507
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PolB-gRNA insert
  • gRNA/shRNA sequence
    PolB exon 14-4
  • Species
    H. sapiens (human)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer ggactatcatatgcttaccgtaac
  • 3′ sequencing primer ccatttgtctgcagaattggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-PolB-gRNA-14-4-hspCas9 was a gift from Robert Sobol (Addgene plasmid # 187206 ; http://n2t.net/addgene:187206 ; RRID:Addgene_187206)
  • For your References section:

    Ubiquitylation of DNA polymerase beta via atypical K27 chains signals a DNA damage response. Fang Q, Koczor CA, Roos WP, McClellan S, Andrews JF, Sobol RW. Nucleic Acids Res. 2026 Apr 13;54(7):gkag344. doi: 10.1093/nar/gkag344. 10.1093/nar/gkag344 PubMed 41978267