pGEX4T3-GST-HA-Ub
(Plasmid
#187589)
-
PurposeHA tagged ubiquitin.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187589 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGEX4T3
-
Backbone manufacturerLife Science
- Total vector size (bp) 5243
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUbiquitin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)228
- Promoter Tac
-
Tag
/ Fusion Protein
- GST (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGATCTGGTTCCGCGTGGATCC
- 3′ sequencing primer CGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX4T3-GST-HA-Ub was a gift from Robert Sobol (Addgene plasmid # 187589 ; http://n2t.net/addgene:187589 ; RRID:Addgene_187589) -
For your References section:
Ubiquitylation of DNA polymerase beta via atypical K27 chains signals a DNA damage response. Fang Q, Koczor CA, Roos WP, McClellan S, Andrews JF, Sobol RW. Nucleic Acids Res. 2026 Apr 13;54(7):gkag344. doi: 10.1093/nar/gkag344. 10.1093/nar/gkag344 PubMed 41978267