mcherry-p62 Double Mutation/Silent
(Plasmid
#187982)
-
PurposeK7A/D69A p62 double mutant (PB1AA). Internal reference: SMC532
-
Depositing Lab
-
Depositing OrganizationUniversity of Vienna
Located in Austria -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 187982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 187982-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 187982-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmCherry-C1 Vector
-
Backbone manufacturerClontech #632524
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 5707
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namep62
-
SpeciesH. sapiens (human)
-
MutationD7A, D69A, silent mutation
-
GenBank ID23636 NM_153719
-
Entrez GeneNUP62 (a.k.a. IBSN, SNDI, p62)
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AAATGGCGTCGCTCACCGTGGCTGCCT
- 3′ sequencing primer TCACAACGGCGGGGGATGCTTTGAATA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 187982-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 187982-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mcherry-p62 Double Mutation/Silent was a gift from Sascha Martens (Addgene plasmid # 187982 ; http://n2t.net/addgene:187982 ; RRID:Addgene_187982) -
For your References section:
Oligomerization of p62 allows for selection of ubiquitinated cargo and isolation membrane during selective autophagy. Wurzer B, Zaffagnini G, Fracchiolla D, Turco E, Abert C, Romanov J, Martens S. Elife. 2015 Sep 28;4:e08941. doi: 10.7554/eLife.08941. 10.7554/eLife.08941 PubMed 26413874