pMpGE010-gR082
(Plasmid
#188553)
-
PurposeBinary vector for CRISPR/Cas9 targeted to MpIGPD in Marchantia polymorpha (for Agrobacterium-mediated genetic transformation)
-
Depositing Lab
-
Depositing OrganizationUtsunomiya University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188553 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 188553-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 188553-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMpGE010
-
Vector typeCRISPR, Gateway Cloning
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegR082
-
gRNA/shRNA sequencecttccctctgagaagacgatgtt
-
SpeciesM. polymorpha
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 188553-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 188553-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMpGE010-gR082 was a gift from Yutaka Kodama (Addgene plasmid # 188553 ; http://n2t.net/addgene:188553 ; RRID:Addgene_188553) -
For your References section:
Selection of a histidine auxotrophic Marchantia polymorpha strain with an auxotrophic selective marker. Fukushima T, Kodama Y. Plant Biotechnol (Tokyo). 2022 Dec 25;39(4):345-354. doi: 10.5511/plantbiotechnology.22.0810a. Epub 2022 Nov 26. 10.5511/plantbiotechnology.22.0810a PubMed 37283617