pCDNA-CRY2-mCh-superPLDx30-P2A-CIBN-CAAX
(Plasmid
#188992)
-
PurposeA plasmid for dual expression of CRY2-mCh-superPLDx30 (an engineered PLD mutant with 30 times higher activity than the wild-type) and plasma membrane-tagged CIBN
-
Depositing Lab
-
Depositing OrganizationCornell University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 188992 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCDNA3.1
- Backbone size w/o insert (bp) 5403
- Total vector size (bp) 9885
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePLD
-
Alt namePhospholipase D
-
SpeciesStreptomyces PMF
-
Insert Size (bp)1527
-
MutationK109R, P245A, G328S, G381V, G429D
- Promoter CMV
-
Tags
/ Fusion Proteins
- CRY2 (N terminal on insert)
- mCherry (N terminal on insert)
- P2A (C terminal on insert)
- CIBN (C terminal on insert)
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer mCh-S (CGTGGAACAGTACGAACGC)
- 3′ sequencing primer CIBN-AS (GGTCACCTCCTATAGCTCCATTC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA-CRY2-mCh-superPLDx30-P2A-CIBN-CAAX was a gift from Jeremy Baskin (Addgene plasmid # 188992 ; http://n2t.net/addgene:188992 ; RRID:Addgene_188992) -
For your References section:
Activity-based directed evolution of a membrane editor in mammalian cells. Tei R, Bagde SR, Fromme JC, Baskin JM. Nat Chem. 2023 May 22. doi: 10.1038/s41557-023-01214-0. 10.1038/s41557-023-01214-0 PubMed 37217787