pCRISPRai
(Plasmid
#189938)
-
PurposeExpresses CRISPRai cassette under EF1a promoter
-
Depositing Lab
-
Depositing OrganizationNational Tsing Hua University
Located in Taiwan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 189938 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 189938-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 189938-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneT&A cloning vector
-
Backbone manufacturerRBC
- Backbone size w/o insert (bp) 2729
- Total vector size (bp) 11410
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPRai cassette
-
SpeciesSynthetic; streptococcus pyogenes
-
Insert Size (bp)9171
- Promoter CMV enhancer-rat EF1 alpha
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAGTAGTGCGCGAGC
- 3′ sequencing primer ACAAGCTTGTCGAGACTGCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 189938-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 189938-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPRai was a gift from Yu-Chen Hu (Addgene plasmid # 189938 ; http://n2t.net/addgene:189938 ; RRID:Addgene_189938) -
For your References section:
CRISPRai for simultaneous gene activation and inhibition to promote stem cell chondrogenesis and calvarial bone regeneration. Truong VA, Hsu MN, Kieu Nguyen NT, Lin MW, Shen CC, Lin CY, Hu YC. Nucleic Acids Res. 2019 Jul 26;47(13):e74. doi: 10.1093/nar/gkz267. 10.1093/nar/gkz267 PubMed 30997496