Skip to main content

pSPL3-hRPH3A_c.1853Gmut
(Plasmid #190479)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190479 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 190479-D50 50 μg of DNA in Tris buffer $495
DNA 190479-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    Pspl3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPH3A (NM_014954.3) c.1853 [exon 20 and part of surrounding introns only]
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    382
  • Mutation
    c.1853A>G
  • Entrez Gene
    RPH3A
  • Promoter SV40

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (unknown if destroyed)
  • 3′ cloning site BamH (unknown if destroyed)
  • 5′ sequencing primer TCTGAGTCACCTGGACAACC
  • 3′ sequencing primer ATCTCAGTGGTATTTGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSPL3-hRPH3A_c.1853Gmut was a gift from Alfredo Brusco (Addgene plasmid # 190479 ; http://n2t.net/addgene:190479 ; RRID:Addgene_190479)
  • For your References section:

    Missense variants in RPH3A cause defects in excitatory synaptic function and are associated with a clinically variable neurodevelopmental disorder. Pavinato L, Stanic J, Barzasi M, Gurgone A, Chiantia G, Cipriani V, Eberini I, Palazzolo L, Di Luca M, Costa A, Marcantoni A, Biamino E, Spada M, Hiatt SM, Kelley WV, Vestito L, Sisodiya SM, Efthymiou S, Chand P, Kaiyrzhanov R, Bruselles A, Cardaropoli S, Tartaglia M, De Rubeis S, Buxbaum JD, Smedley D, Ferrero GB, Giustetto M, Gardoni F, Brusco A. Genet Med. 2023 Nov;25(11):100922. doi: 10.1016/j.gim.2023.100922. Epub 2023 Jul 1. 10.1016/j.gim.2023.100922 PubMed 37403762