p27-mVenus reporter (PB)
(Plasmid
#190731)
-
PurposeThe p27 reporter vector, which expresses mVenus-fused, mutant (K–) p27 protein with a defective CDK binding.
-
Depositing Lab
-
Depositing OrganizationKeio University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 190731-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 190731-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePB533A-2
-
Backbone manufacturerSystem Biosciences
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namemVenus
- Promoter EF1α
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer CCGCttacgtctggcgtcgaa
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namep27
-
Alt nameCDKN1B
-
SpeciesH. sapiens (human)
-
Mutationp27-F62A-F64A
- Promoter EF1α
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer ATGGTGAGCAAGGGCGAGGA
- 3′ sequencing primer CCGCttacgtctggcgtcgaa
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 190731-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 190731-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p27-mVenus reporter (PB) was a gift from Toshiro Sato (Addgene plasmid # 190731 ; http://n2t.net/addgene:190731 ; RRID:Addgene_190731) -
For your References section:
Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028
