-
PurposeFluorescent reporter vector to visualize all of cell cycle phases.
-
Depositing Lab
-
Depositing OrganizationKeio University
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 190181 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 190181-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 190181-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonePB510B-1
-
Backbone manufacturerSystem Biosciences
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameiRFP
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (unknown if destroyed)
- 3′ cloning site XbaI (unknown if destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer Unknown
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namehCdt1(1/100)Cy(-)
-
Alt nameCDT1
-
SpeciesSynthetic
-
Entrez GeneCdt1 (a.k.a. 2610318F11Rik, DUP, Ris2)
- Promoter CMV
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer Unknown
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameTagBFP2
-
SpeciesSynthetic
- Promoter CMV
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
- 3′ sequencing primer tacaaaggcattaaagcagcgta
- (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert namehGeminin(1/110)
-
Alt nameGMNN
-
SpeciesSynthetic
-
GenBank IDNM_001251989.2
- Promoter CMV
Cloning Information for Gene/Insert 4
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (unknown if destroyed)
- 3′ cloning site NdeI (unknown if destroyed)
- 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
- 3′ sequencing primer AAACAACAGATGGCTGGCAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 190181-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 190181-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fucci(CA) hCdt1-iRFP hGeminin-TagBFP2 was a gift from Toshiro Sato (Addgene plasmid # 190181 ; http://n2t.net/addgene:190181 ; RRID:Addgene_190181) -
For your References section:
Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028