Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Fucci(CA) hCdt1-iRFP hGeminin-TagBFP2
(Plasmid #190181)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 190181 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PB510B-1
  • Backbone manufacturer
    System Biosciences
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    iRFP
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer Unknown
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    hCdt1(1/100)Cy(-)
  • Alt name
    CDT1
  • Species
    Synthetic
  • Entrez Gene
    Cdt1 (a.k.a. 2610318F11Rik, DUP, Ris2)
  • Promoter CMV

Cloning Information for Gene/Insert 2

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cgcaaatgggcggtaggcgtg
  • 3′ sequencing primer Unknown
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    TagBFP2
  • Species
    Synthetic
  • Promoter CMV

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site AvrII (unknown if destroyed)
  • 3′ cloning site NdeI (unknown if destroyed)
  • 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
  • 3′ sequencing primer tacaaaggcattaaagcagcgta
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    hGeminin(1/110)
  • Alt name
    GMNN
  • Species
    Synthetic
  • GenBank ID
    NM_001251989.2
  • Promoter CMV

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (unknown if destroyed)
  • 3′ cloning site NdeI (unknown if destroyed)
  • 5′ sequencing primer GAAGAAAACACTCGGCTGGGA
  • 3′ sequencing primer AAACAACAGATGGCTGGCAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fucci(CA) hCdt1-iRFP hGeminin-TagBFP2 was a gift from Toshiro Sato (Addgene plasmid # 190181 ; http://n2t.net/addgene:190181 ; RRID:Addgene_190181)
  • For your References section:

    Cell-matrix interface regulates dormancy in human colon cancer stem cells. Ohta Y, Fujii M, Takahashi S, Takano A, Nanki K, Matano M, Hanyu H, Saito M, Shimokawa M, Nishikori S, Hatano Y, Ishii R, Sawada K, Machinaga A, Ikeda W, Imamura T, Sato T. Nature. 2022 Jul 7. pii: 10.1038/s41586-022-05043-y. doi: 10.1038/s41586-022-05043-y. 10.1038/s41586-022-05043-y PubMed 35798028