pDEST_6xUAS:miRFP670-cetn4
(Plasmid #192357)

• Purpose: zfCETN4 tagged with miRFP670, expressed under the UAS promoter
• Depositing Lab: Darren Gilmour
• Publication: Moller et al Elife. 2022 Nov 18;11:e82094. doi: 10.7554/eLife.82094.

Backbone

• Vector backbone: Gateway Tol2 destination vector with zebrafish aA-crystallin promoter driving mKate2 in lens
• Total vector size (bp): 7517
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CETN4
• Species: D. rerio (zebrafish)
• Insert Size (bp): 511
• GenBank ID: 795310
• Entrez Gene: cetn4 (a.k.a. cb732, cetn2)
• Tag / Fusion Protein:
  • miRFP670 (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: gtctgaaacacaggccagat
• 3′ sequencing primer: CCACATTTGTAGAGGTTTTACTTGC

Resource Information

• Supplemental Documents:
  • pdest_tol2-crymkate_6xuasmirfp670-zfcetn4.gb
• A portion of this plasmid was derived from a plasmid made by: The CETN4 cDNA was a gift from the Gilmour lab, originally published in Revenu et al., 2014.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
  • National Institute of Genetics Limited Use Label License for Tol2 System
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2022.08.12.503784v1 bioRxiv preprint.