Skip to main content

pSEVA351-Cpf1
(Plasmid #192361)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192361 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 192361-D50 50 μg of DNA in Tris buffer $495
DNA 192361-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSEVA351
  • Backbone manufacturer
    SEVA collection
  • Backbone size w/o insert (bp) 5120
  • Total vector size (bp) 9859
  • Modifications to backbone
    Insertion of a CRISPR-Cas12 cassette
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas12a, gRNA scaffold
  • Alt name
    Cpf1
  • Species
    Francisella novicida
  • Insert Size (bp)
    4757

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer gGATCCtcgatgtaacccactcgtgc
  • 3′ sequencing primer agttggtaccgtcgacctgca
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ungerer, J., & Pakrasi, H. B. (2016). Cpf1 is a versatile tool for CRISPR genome editing across diverse species of cyanobacteria. Scientific reports, 6(1), 1-9.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

CRISPR cassette form the vector pSL2680

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEVA351-Cpf1 was a gift from Juana María Navarro Llorens (Addgene plasmid # 192361 ; http://n2t.net/addgene:192361 ; RRID:Addgene_192361)
  • For your References section:

    SEVA-Cpf1, a CRISPR-Cas12a vector for genome editing in cyanobacteria. Baldanta S, Guevara G, Navarro-Llorens JM. Microb Cell Fact. 2022 May 28;21(1):103. doi: 10.1186/s12934-022-01830-4. 10.1186/s12934-022-01830-4 PubMed 35643551