Skip to main content

pCBI-CRY2PHR-VPR
(Plasmid #192606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 192606 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 192606-D50 50 μg of DNA in Tris buffer $495
DNA 192606-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAGGS
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRY2PHR-VPR
  • Species
    Synthetic
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgtgaccggcggctctagctaga
  • 3′ sequencing primer tgtccttccgagtgagagacac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCBI-CRY2PHR-VPR was a gift from Yingxiao Wang (Addgene plasmid # 192606 ; http://n2t.net/addgene:192606 ; RRID:Addgene_192606)
  • For your References section:

    Engineering light-controllable CAR T cells for cancer immunotherapy. Huang Z, Wu Y, Allen ME, Pan Y, Kyriakakis P, Lu S, Chang YJ, Wang X, Chien S, Wang Y. Sci Adv. 2020 Feb 19;6(8):eaay9209. doi: 10.1126/sciadv.aay9209. eCollection 2020 Feb. 10.1126/sciadv.aay9209 PubMed 32128416