pX330-FOXL2-cterm
(Plasmid
#192893)
-
PurposeExpresses Cas9 and sgRNA targeting the C-terminus region of FOXL2
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 192893 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 192893-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 192893-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8466
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFOXL2 C-term sgRNA
-
gRNA/shRNA sequenceCGTCTGCACCGGCATGCGGT
-
SpeciesSynthetic
-
Insert Size (bp)21
-
Entrez GeneFOXL2 (a.k.a. BPES, BPES1, PFRK, PINTO, POF3)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (destroyed during cloning)
- 3′ cloning site BbsI (destroyed during cloning)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Also expresses Cas9 with nuclear localization signals.
DNA (Catalog # 192893-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 192893-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX330-FOXL2-cterm was a gift from George Church (Addgene plasmid # 192893 ; http://n2t.net/addgene:192893 ; RRID:Addgene_192893) -
For your References section:
Directed differentiation of human iPSCs to functional ovarian granulosa-like cells via transcription factor overexpression. Pierson Smela MD, Kramme CC, Fortuna PRJ, Adams JL, Su R, Dong E, Kobayashi M, Brixi G, Kavirayuni VS, Tysinger E, Kohman RE, Shioda T, Chatterjee P, Church GM. Elife. 2023 Feb 21;12:e83291. doi: 10.7554/eLife.83291. 10.7554/eLife.83291 PubMed 36803359
