pMXs-Sox2AV
(Plasmid
#193354)
-
PurposeRetroviral vector expressing mouse Sox2A61V point mutant
-
Depositing Lab
-
Depositing OrganizationMax Planck Institute for Molecular Biomedicine
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs
- Backbone size w/o insert (bp) 4627
- Total vector size (bp) 5607
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSox2AV
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)980
-
MutationSox2A61V is a highly cooperative point mutant of Sox2
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
- Promoter 5'LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer gacggcatcgcagcttggatacac
- 3′ sequencing primer CCCTTTTTCTGGAGACTAAATAAAATC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.09.23.509242v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-Sox2AV was a gift from Hans Schöler (Addgene plasmid # 193354 ; http://n2t.net/addgene:193354 ; RRID:Addgene_193354) -
For your References section:
Highly cooperative chimeric super-SOX induces naive pluripotency across species. MacCarthy CM, Wu G, Malik V, Menuchin-Lasowski Y, Velychko T, Keshet G, Fan R, Bedzhov I, Church GM, Jauch R, Cojocaru V, Scholer HR, Velychko S. Cell Stem Cell. 2024 Jan 4;31(1):127-147.e9. doi: 10.1016/j.stem.2023.11.010. Epub 2023 Dec 22. 10.1016/j.stem.2023.11.010 PubMed 38141611