H1.99.luc
(Plasmid
#193663)
-
PurposeExpresses a truncated Polymerase III H1 promoter of 99 nucleotides (H1-99)
-
Depositing Lab
-
Depositing OrganizationAcademic Medical Center, University of Amsterdam (inactive)
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 193663 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 193663-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 193663-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL3-basic vector
-
Backbone manufacturerPromega
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTruncated Pol III H1 promoter (H1.99) + 41 nucleotides
-
Alt nameH1.99
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCCC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 193663-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 193663-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
H1.99.luc was a gift from Elena Herrera-Carrillo (Addgene plasmid # 193663 ; http://n2t.net/addgene:193663 ; RRID:Addgene_193663) -
For your References section:
Engineered mini H1 promoters with dedicated RNA Polymerase II or III activity. Gao Z, van der Velden YU, Fan M, van der Linden CA, Vink M, Herrera-Carrillo E, Berkhout B. J Biol Chem. 2020 Nov 5. pii: S0021-9258(20)00012-5. doi: 10.1074/jbc.RA120.015386. 10.1074/jbc.RA120.015386 PubMed 33154168
