pRMC2-sec:msfGFP
(Plasmid #194914)

• Purpose: Tetracycline inducible expression of msfGFP fused to Sec signal peptide in Staphylococci
• Depositing Lab: Rikke Meyer
• Publication: Evans et al Microb Cell. 2023 Jun 28;10(7):145-156. doi: 10.15698/mic2023.07.800. eCollection 2023 Jul 3.

Backbone

• Vector backbone: pRMC2
• Backbone manufacturer: Tim Foster; Addgene #68940
• Backbone size w/o insert (bp): 6000
• Total vector size (bp): 7223
• Modifications to backbone: Sec signal peptide-monomeric superfolder GFP fusion inserted into MCS via restriction enzymes. Shine Dalgarno sequence inserted via site directed mutagenesis.
• Vector type: Bacterial Expression ; Tetracycline-inducible expression vector for Staphylococcus aureus

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Chloramphenicol should be used when transformed in S. Aureus.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Shine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
• Species: S. aureus
• Insert Size (bp): 815

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTCTTCGCTATTACGCCAGC
• 3′ sequencing primer: TGGATCCCCTCGAGTTCATG

Resource Information

• Supplemental Documents:
  • pRMC2-SD-SecSP-msfGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry