Skip to main content

pRMC2-sec:msfGFP
(Plasmid #194914)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 194914 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pRMC2
  • Backbone manufacturer
    Tim Foster; Addgene #68940
  • Backbone size w/o insert (bp) 6000
  • Total vector size (bp) 7223
  • Modifications to backbone
    Sec signal peptide-monomeric superfolder GFP fusion inserted into MCS via restriction enzymes. Shine Dalgarno sequence inserted via site directed mutagenesis.
  • Vector type
    Bacterial Expression ; Tetracycline-inducible expression vector for Staphylococcus aureus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Chloramphenicol should be used when transformed in S. Aureus.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Shine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
  • Species
    S. aureus
  • Insert Size (bp)
    815

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CTCTTCGCTATTACGCCAGC
  • 3′ sequencing primer TGGATCCCCTCGAGTTCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRMC2-sec:msfGFP was a gift from Rikke Meyer (Addgene plasmid # 194914 ; http://n2t.net/addgene:194914 ; RRID:Addgene_194914)
  • For your References section:

    GFP fusions of Sec-routed extracellular proteins in Staphylococcus aureus reveal surface-associated coagulase in biofilms. Evans DCS, Khamas AB, Marcussen L, Rasmussen KS, Klitgaard JK, Kallipolitis BH, Nielsen J, Otzen DE, Leake MC, Meyer RL. Microb Cell. 2023 Jun 28;10(7):145-156. doi: 10.15698/mic2023.07.800. eCollection 2023 Jul 3. 10.15698/mic2023.07.800 PubMed 37395997