pRMC2-sec:msfGFP
(Plasmid
#194914)
-
PurposeTetracycline inducible expression of msfGFP fused to Sec signal peptide in Staphylococci
-
Depositing Lab
-
Depositing OrganizationAarhus University
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 194914 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRMC2
-
Backbone manufacturerTim Foster; Addgene #68940
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 7223
-
Modifications to backboneSec signal peptide-monomeric superfolder GFP fusion inserted into MCS via restriction enzymes. Shine Dalgarno sequence inserted via site directed mutagenesis.
-
Vector typeBacterial Expression ; Tetracycline-inducible expression vector for Staphylococcus aureus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsChloramphenicol should be used when transformed in S. Aureus.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameShine Dalgarno sequence followed by Sec signal peptide fused to monomeric superfolder GFP
-
SpeciesS. aureus
-
Insert Size (bp)815
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CTCTTCGCTATTACGCCAGC
- 3′ sequencing primer TGGATCCCCTCGAGTTCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRMC2-sec:msfGFP was a gift from Rikke Meyer (Addgene plasmid # 194914 ; http://n2t.net/addgene:194914 ; RRID:Addgene_194914) -
For your References section:
GFP fusions of Sec-routed extracellular proteins in Staphylococcus aureus reveal surface-associated coagulase in biofilms. Evans DCS, Khamas AB, Marcussen L, Rasmussen KS, Klitgaard JK, Kallipolitis BH, Nielsen J, Otzen DE, Leake MC, Meyer RL. Microb Cell. 2023 Jun 28;10(7):145-156. doi: 10.15698/mic2023.07.800. eCollection 2023 Jul 3. 10.15698/mic2023.07.800 PubMed 37395997