-
Purpose(Empty Backbone) tetracycline-inducible expression vector for Staphylococcus aureus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 68940 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepALC2073
-
Vector typeBacterial Expression ; tet inducible E. coli/Staphylococcus shuttle vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsChloramphenicol should be used when transformed in S. Aureus.
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pRMC2 SEQF: ATTCAGGCTGCGCAAC
- 3′ sequencing primer pRMC2 SEQR: TTGTTGACATTATATCATTG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note--MCS is inverted in the article describing this plasmid. Addgene's sequencing results with the pRMC2 SEQF primer find the MCS is duplicated, presumably due to the cloning strategy.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRMC2 was a gift from Tim Foster (Addgene plasmid # 68940 ; http://n2t.net/addgene:68940 ; RRID:Addgene_68940) -
For your References section:
An improved tetracycline-inducible expression vector for Staphylococcus aureus. Corrigan RM, Foster TJ. Plasmid. 2009 Mar;61(2):126-9. doi: 10.1016/j.plasmid.2008.10.001. Epub 2008 Nov 25. 10.1016/j.plasmid.2008.10.001 PubMed 18996145
