Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRMC2
(Plasmid #68940)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 68940 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pALC2073
  • Vector type
    Bacterial Expression ; tet inducible E. coli/Staphylococcus shuttle vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Chloramphenicol should be used when transformed in S. Aureus.
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer pRMC2 SEQF: ATTCAGGCTGCGCAAC
  • 3′ sequencing primer pRMC2 SEQR: TTGTTGACATTATATCATTG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Note--MCS is inverted in the article describing this plasmid. Addgene's sequencing results with the pRMC2 SEQF primer find the MCS is duplicated, presumably due to the cloning strategy.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRMC2 was a gift from Tim Foster (Addgene plasmid # 68940 ; http://n2t.net/addgene:68940 ; RRID:Addgene_68940)
  • For your References section:

    An improved tetracycline-inducible expression vector for Staphylococcus aureus. Corrigan RM, Foster TJ. Plasmid. 2009 Mar;61(2):126-9. doi: 10.1016/j.plasmid.2008.10.001. Epub 2008 Nov 25. 10.1016/j.plasmid.2008.10.001 PubMed 18996145