Skip to main content

221-pCAGGS-HA-AID-CTCFcDNA-AID-eGFP-2A-blasticidin
(Plasmid #195101)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195101 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 195101-D50 50 μg of DNA in Tris buffer $495
DNA 195101-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pENTR221
  • Total vector size (bp) 8087
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CTCF
  • Species
    H. sapiens (human)
  • Entrez Gene
    CTCF (a.k.a. CFAP108, FAP108, MRD21)
  • Promoter pCAGGS
  • Tags / Fusion Proteins
    • eGFP (C terminal on insert)
    • AID (C terminal on insert)
    • AID (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACCATGTTCATGC
  • 3′ sequencing primer GGTGGTGCAGATGAACTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The CTCF cDNA was amplified from a pCMV6-Entry vector containing CTCF cDNA (Origene, RC202416)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    221-pCAGGS-HA-AID-CTCFcDNA-AID-eGFP-2A-blasticidin was a gift from Job Dekker (Addgene plasmid # 195101 ; http://n2t.net/addgene:195101 ; RRID:Addgene_195101)
  • For your References section:

    A cohesin traffic pattern genetically linked to gene regulation. Valton AL, Venev SV, Mair B, Khokhar ES, Tong AHY, Usaj M, Chan K, Pai AA, Moffat J, Dekker J. Nat Struct Mol Biol. 2022 Dec 8. doi: 10.1038/s41594-022-00890-9. 10.1038/s41594-022-00890-9 PubMed 36482254