221-RPB1-AID-eGFP-2A-blasticidin
(Plasmid
#195107)
-
PurposeTargeting vector to introduce AID-eGFP tags in C-terminal of the human RPB1 gene. Blasticidin selection (2A-fusion). Auxin-inducible degron system.
-
Depositing Lab
-
Depositing OrganizationUniversity of Massachusetts, Worcester
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195107 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 195107-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 195107-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepENTR221
- Total vector size (bp) 6956
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAID-eGFP
-
SpeciesH. sapiens (human)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AACATCTCCTACTTATTCCCCAACC
- 3′ sequencing primer GGTGGTGCAGATGAACTTCAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe minimal functional AID tag (aa 71-114)-eGFP was amplified from pEN244-CTCF-AID[71-114]-eGFP-FRT-Blast-FRT (Addgene plasmid #92140)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2021.07.29.454218v1 for bioRxiv preprint.
DNA (Catalog # 195107-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 195107-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
221-RPB1-AID-eGFP-2A-blasticidin was a gift from Job Dekker (Addgene plasmid # 195107 ; http://n2t.net/addgene:195107 ; RRID:Addgene_195107) -
For your References section:
A cohesin traffic pattern genetically linked to gene regulation. Valton AL, Venev SV, Mair B, Khokhar ES, Tong AHY, Usaj M, Chan K, Pai AA, Moffat J, Dekker J. Nat Struct Mol Biol. 2022 Dec 8. doi: 10.1038/s41594-022-00890-9. 10.1038/s41594-022-00890-9 PubMed 36482254