Skip to main content

221-RPB1-AID-eGFP-2A-blasticidin
(Plasmid #195107)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195107 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pENTR221
  • Total vector size (bp) 6956
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AID-eGFP
  • Species
    H. sapiens (human)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AACATCTCCTACTTATTCCCCAACC
  • 3′ sequencing primer GGTGGTGCAGATGAACTTCAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The minimal functional AID tag (aa 71-114)-eGFP was amplified from pEN244-CTCF-AID[71-114]-eGFP-FRT-Blast-FRT (Addgene plasmid #92140)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    221-RPB1-AID-eGFP-2A-blasticidin was a gift from Job Dekker (Addgene plasmid # 195107 ; http://n2t.net/addgene:195107 ; RRID:Addgene_195107)
  • For your References section:

    A cohesin traffic pattern genetically linked to gene regulation. Valton AL, Venev SV, Mair B, Khokhar ES, Tong AHY, Usaj M, Chan K, Pai AA, Moffat J, Dekker J. Nat Struct Mol Biol. 2022 Dec 8. doi: 10.1038/s41594-022-00890-9. 10.1038/s41594-022-00890-9 PubMed 36482254
Commonly requested with: