GFP-itis pSel
(Plasmid
#195344)
-
PurposeSelection plasmid expressing non-fluorescent EGFP A111V
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Diego (UCSD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 195344 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 195344-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 195344-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneunknown
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
-
Alt nameEnhanced green fluorescent protein
-
SpeciesSynthetic; Aequorea victoria
-
Insert Size (bp)717
-
MutationA111V
-
GenBank IDU55762
- Promoter J23119
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGCTATCAGGACATAGCGTTGGCTA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.06.527367v1 for bioRxiv preprint.
DNA (Catalog # 195344-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 195344-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-itis pSel was a gift from Alexis Komor (Addgene plasmid # 195344 ; http://n2t.net/addgene:195344 ; RRID:Addgene_195344) -
For your References section:
Curing "GFP-itis" in Bacteria with Base Editors: Development of a Genome Editing Science Program Implemented with High School Biology Students. Vasquez CA, Evanoff M, Ranzau BL, Gu S, Deters E, Komor AC. CRISPR J. 2023 Apr 20. doi: 10.1089/crispr.2023.0002. 10.1089/crispr.2023.0002 PubMed 37083425
Map uploaded by the depositor.
