Skip to main content

pCAG-Myc-GRM1-IRES-CyRFP1
(Plasmid #195355)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195355 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 195355-D50 50 μg of DNA in Tris buffer $495
DNA 195355-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAGGs
  • Backbone size w/o insert (bp) 6078
  • Total vector size (bp) 11005
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    GRM1-IRES-CyRFP1
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    4927
  • Promoter pCAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer caggtgcaggctgcctatc
  • 3′ sequencing primer gcacagtcgaggctgatcagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Myc-GRM1-IRES-CyRFP1 was a gift from Brenda Bloodgood (Addgene plasmid # 195355 ; http://n2t.net/addgene:195355 ; RRID:Addgene_195355)
  • For your References section:

    Electrical signals in the ER are cell type and stimulus specific with extreme spatial compartmentalization in neurons. Campbell EP, Abushawish AA, Valdez LA, Bell MK, Haryono M, Rangamani P, Bloodgood BL. Cell Rep. 2023 Jan 31;42(1):111943. doi: 10.1016/j.celrep.2022.111943. Epub 2023 Jan 5. 10.1016/j.celrep.2022.111943 PubMed 36640310