Skip to main content

pCMV-MMLV-gag-hMLH1dn
(Plasmid #195513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 195513 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 195513-D50 50 μg of DNA in Tris buffer $495
DNA 195513-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV-MMLVgag-3xNES-Cas9
  • Backbone manufacturer
    David Liu
  • Backbone size w/o insert (bp) 4021
  • Total vector size (bp) 10783
  • Vector type
    Mammalian Expression ; Virus like particle

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hMLH1dn
  • Alt name
    Human MLH1 del754-756
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2256
  • Mutation
    Human MLH1 del754-756
  • Entrez Gene
    MLH1 (a.k.a. COCA2, FCC2, HNPCC, HNPCC2, LYNCH2, MLH-1, MMRCS1, hMLH1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • Protease cleavate site (N terminal on backbone)
    • NES (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ctctgagtccaaaccgggcc
  • 3′ sequencing primer CCCATATGTCCTTCCGAGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-MMLV-gag-hMLH1dn was a gift from Hyongbum Kim (Addgene plasmid # 195513 ; http://n2t.net/addgene:195513 ; RRID:Addgene_195513)
  • For your References section:

    Prediction of efficiencies for diverse prime editing systems in multiple cell types. Yu G, Kim HK, Park J, Kwak H, Cheong Y, Kim D, Kim J, Kim J, Kim HH. Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034. 10.1016/j.cell.2023.03.034 PubMed 37119812