pLenti_gRNA -hMLHdn-Puro
(Plasmid #191105)

• Purpose: Backbone for lentiviral pegRNA library construction with hMLH1dn and Puro marker
• Depositing Lab: Hyongbum Kim
• Publication: Yu et al Cell. 2023 Apr 21:S0092-8674(23)00331-8. doi: 10.1016/j.cell.2023.03.034.

Backbone

• Vector backbone: Lenti_gRNA-Puro
• Backbone manufacturer: Hyongbum Kim
• Backbone size w/o insert (bp): 8261
• Total vector size (bp): 10673
• Modifications to backbone: hMLH1dn for MMR knockdown
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hMLH1dn
• Alt name: Human MLH1 del754-756 with P2A
• Species: H. sapiens (human)
• Insert Size (bp): 2327
• Mutation: I31 silent mutation (ATA to ATC) to remove early termination signal
• Promoter: EF-1a

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: GTGGGCTTGTACTCGGTCAT

Resource Information

• Supplemental Documents:
  • pLenti-gDNA-hMLH1dn-Puro.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry