pCEC-red
(Plasmid
#196040)
-
Purpose(Empty Backbone) Allows the expression of Cas9 in Saccharomyces cerevisiae and contains a gRNA expression unit with a mRFP1 placeholder for user-defined gRNA insertion using BsaI-mediated Golden Gate Assembly
-
Depositing Lab
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196040 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCEC-red
-
Backbone manufacturerIndBioTech Lab
- Backbone size (bp) 10373
-
Modifications to backboneThe backbone was synthetically assembled from parts of other plasmids. It bears an mRFP1 placeholder that is excided upon cloning
-
Vector typeYeast Expression, CRISPR, Synthetic Biology ; gRNA cloning
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- 3′ sequencing primer CTAGATTTTGTAGTGCCCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid was synthetically assembled from parts of other vectors: GGE114 (a gift from Tristan Rossignol (Addgene plasmid # 120731 ; http://n2t.net/addgene:120731 ; RRID:Addgene_120731)); pML104 (a gift from John Wyrick (Addgene plasmid # 67638 ; http://n2t.net/addgene:67638 ; RRID:Addgene_67638); pGGA_KANMX (unpublished)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCEC-red was a gift from Paola Branduardi (Addgene plasmid # 196040 ; http://n2t.net/addgene:196040 ; RRID:Addgene_196040) -
For your References section:
pCEC-red: a new vector for easier and faster CRISPR-Cas9 genome editing in Saccharomyces cerevisiae. Maestroni L, Butti P, Senatore VG, Branduardi P. FEMS Yeast Res. 2023 Jan 4;23:foad002. doi: 10.1093/femsyr/foad002. 10.1093/femsyr/foad002 PubMed 36640150