Skip to main content

pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-A10
(Plasmid #196085)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 196085 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 196085-D50 50 μg of DNA in Tris buffer $495
DNA 196085-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-SapI
  • Backbone manufacturer
    Czarnek et al., 2021
  • Backbone size w/o insert (bp) 11264
  • Total vector size (bp) 11267
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA targeting Adam10
  • Species
    Synthetic
  • Mutation
    Cloned using SapI sites - destroyed after insertion

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SapI (destroyed during cloning)
  • 3′ cloning site SapI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBtet-Pur-dCas9-KRAB-MeCP2_hU6-A10 was a gift from Joanna Bereta (Addgene plasmid # 196085 ; http://n2t.net/addgene:196085 ; RRID:Addgene_196085)
  • For your References section:

    Construction of a Set of Novel Transposon Vectors for Efficient Silencing of Protein and lncRNA Genes via CRISPR Interference. Czarnek M, Kochan J, Wawro M, Myrczek R, Bereta J. Mol Biotechnol. 2023 Jan 28. doi: 10.1007/s12033-023-00675-5. 10.1007/s12033-023-00675-5 PubMed 36707469