CAGGS-EGFP-NLS-3XFLAG-V5
(Plasmid
#196090)
-
PurposeExpresses gfp in mammalian cells. Contains a c-terminal 3xFlag tag and a c-terminal V5 tag
-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 196090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 196090-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 196090-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAddgene Plasmid #196383
-
Backbone manufacturerGenewiz
- Backbone size w/o insert (bp) 8794
- Total vector size (bp) 9515
-
Modifications to backboneInsertion of eGFP cDNA in AvrII and NotI sites.
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)721
- Promoter CAGGs
-
Tags
/ Fusion Proteins
- C-terminal 3xFLAG (C terminal on backbone)
- C-terminal V5 (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggctctagagcctctgctaa
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAzenta (Genewiz)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 196090-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 196090-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CAGGS-EGFP-NLS-3XFLAG-V5 was a gift from Mauro Calabrese (Addgene plasmid # 196090 ; http://n2t.net/addgene:196090 ; RRID:Addgene_196090) -
For your References section:
SAFB associates with nascent RNAs and can promote gene expression in mouse embryonic stem cells. Cherney R, Eberhard Q, Giri G, Mills C, Porrello A, Zhang Z, White D, Trotman JB, Herring L, Dominguez D, Calabrese M. RNA. 2023 Jul 19:rna.079569.122. doi: 10.1261/rna.079569.122. 10.1261/rna.079569.122 PubMed 37468167
