Skip to main content

pcmv3-IRG1-L272Q-HA
(Plasmid #198184)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 198184 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 198184-D50 50 μg of DNA in Tris buffer $495
DNA 198184-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcmv3
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ACOD1
  • Alt name
    IRG1
  • Species
    H. sapiens (human)
  • Mutation
    The leucine in IRG1 at position 272 mutates to glutarnine
  • GenBank ID
    NM_001258406.2
  • Entrez Gene
    ACOD1 (a.k.a. CAD, IRG1)
  • Promoter CMV
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TGGCCATACACTTGAGTGAC
  • 3′ sequencing primer ACAGTGGGAGTGGCACCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcmv3-IRG1-L272Q-HA was a gift from Yun Zhao (Addgene plasmid # 198184 ; http://n2t.net/addgene:198184 ; RRID:Addgene_198184)
  • For your References section:

    4-octyl itaconate as a metabolite derivative inhibits inflammation via alkylation of STING. Li W, Li Y, Kang J, Jiang H, Gong W, Chen L, Wu C, Liu M, Wu X, Zhao Y, Ren J. Cell Rep. 2023 Mar 28;42(3):112145. doi: 10.1016/j.celrep.2023.112145. Epub 2023 Feb 28. 10.1016/j.celrep.2023.112145 PubMed 36862550