pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE
(Plasmid
and Viral Vector Preps for
#198516)
-
PurposeExpresses optimized PdCO in frame with mScarlet under control of eukaryotic Ef1a promoter after Cre-dependent recombination.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198516 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| AAV1 | 198516-AAV1 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $459 | ||
| AAV5 | 198516-AAV5 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $459 | ||
Don’t see the serotype you want?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4993
- Total vector size (bp) 6829
-
Modifications to backbonedirectional Cre-lox sites
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePdCO
-
Alt namePlatynereis dumerilii Ciliary Opsin, optimized for mammalian neuron expression and enhanced axonal membrane trafficking
-
SpeciesSynthetic; Platynereis dumerilii
-
Insert Size (bp)1896
-
GenBank IDAY692353.1
- Promoter EF-1a
-
Tags
/ Fusion Proteins
- mScarlet (C terminal on insert)
- Rho1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SgsI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer EF1a_F (tgccctttttgagtttggatcttggt)
- 3′ sequencing primer minWPRE_R (gtccgcacgtgctttaaaaaac)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.07.01.547328v1 for bioRxiv preprint.
AAV1 (Catalog # 198516-AAV1)
Purpose
Ready-to-use AAV1 particles produced from pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (#198516). In addition to the viral particles, you will also receive purified pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE plasmid DNA.
Ef1a-driven, Cre-dependent expression of the optimized opsin PdCO in frame with mScarlet. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mScarlet
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
AAV5 (Catalog # 198516-AAV5)
Purpose
Ready-to-use AAV5 particles produced from pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (#198516). In addition to the viral particles, you will also receive purified pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE plasmid DNA.
Ef1a-driven, Cre-dependent expression of the optimized opsin PdCO in frame with mScarlet. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
- Reporter Gene mScarlet
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE was a gift from Ofer Yizhar (Addgene plasmid # 198516 ; http://n2t.net/addgene:198516 ; RRID:Addgene_198516) For viral preps, please replace (Addgene plasmid # 198516) in the above sentence with: (Addgene viral prep # 198516-AAV1) or (Addgene viral prep # 198516-AAV5) -
For your References section:
A bistable inhibitory optoGPCR for multiplexed optogenetic control of neural circuits. Wietek J, Nozownik A, Pulin M, Saraf-Sinik I, Matosevich N, Gowrishankar R, Gat A, Malan D, Brown BJ, Dine J, Imambocus BN, Levy R, Sauter K, Litvin A, Regev N, Subramaniam S, Abrera K, Summarli D, Goren EM, Mizrachi G, Bitton E, Benjamin A, Copits BA, Sasse P, Rost BR, Schmitz D, Bruchas MR, Soba P, Oren-Suissa M, Nir Y, Wiegert JS, Yizhar O. Nat Methods. 2024 May 29. doi: 10.1038/s41592-024-02285-8. 10.1038/s41592-024-02285-8 PubMed 38811857