pCI-neo-(HA)3-ε
(Plasmid
#198531)
-
PurposeExpression of HA-tagged AP-4 ε in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNational Institute of Child Health and Human Development (NICHD)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 198531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 198531-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 198531-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCI-neo
- Backbone size w/o insert (bp) 5474
- Total vector size (bp) 8971
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAP-4 ε
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3522
-
Mutationsilent substitutions in codons 235, 262, 905 and 1129
-
Entrez GeneAP4E1 (a.k.a. CPSQ4, SPG51, STUT1)
- Promoter CMV
-
Tag
/ Fusion Protein
- triple HA tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer pCI-neo forward: 5’ CTCTCCACAGGTGTCCACTCCCAGTTC
- 3′ sequencing primer pCI-neo reverse: 5’ CACTGCATTCTAGTTGTGGTTTGTCCAAACTCATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
triple HA tag subcloned between XhoI and EcoRI sites, AP-4 ε subcloned betwen EcoRI and SalI sites; all sites are intact
DNA (Catalog # 198531-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 198531-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-neo-(HA)3-ε was a gift from Juan Bonifacino (Addgene plasmid # 198531 ; http://n2t.net/addgene:198531 ; RRID:Addgene_198531) -
For your References section:
AP-4 mediates export of ATG9A from the trans-Golgi network to promote autophagosome formation. Mattera R, Park SY, De Pace R, Guardia CM, Bonifacino JS. Proc Natl Acad Sci U S A. 2017 Dec 12;114(50):E10697-E10706. doi: 10.1073/pnas.1717327114. Epub 2017 Nov 27. 10.1073/pnas.1717327114 PubMed 29180427