pEGFP-C3-Rabaptin-5
(Plasmid
#199173)
-
PurposeExpresses GFP-Rabaptin-5 fusion in mammalian cells
-
Depositing Lab
-
Depositing OrganizationNational Institute of Child Health and Human Development (NICHD)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199173 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 199173-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 199173-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C3
- Backbone size w/o insert (bp) 4727
- Total vector size (bp) 7452
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRabaptin-5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2726
-
MutationContains Tyr 149 Ser substitution; insert starts at codon 6 (encodes human Rabaptin-5 (6-862))
-
Entrez GeneRABEP1 (a.k.a. RAB5EP, RABPT5)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SmaI (destroyed during cloning)
- 3′ cloning site SmaI (destroyed during cloning)
- 5′ sequencing primer pEGFP-C forward: 5’ CATGGTCCTGCTGGAGTTCGTG
- 3′ sequencing primer pEGFP-C reverse: 5’ GCTTTATTTGTGAAATTTGTGATGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ApaI/NotI Rabaptin-5 insert was polished with T7 DNA polymerase and subcloned into SmaI site of pEGFP-C3 vector. Insert contains ~140 bp of 3' UTR after stop codon.
DNA (Catalog # 199173-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 199173-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-C3-Rabaptin-5 was a gift from Juan Bonifacino (Addgene plasmid # 199173 ; http://n2t.net/addgene:199173 ; RRID:Addgene_199173) -
For your References section:
Divalent interaction of the GGAs with the Rabaptin-5-Rabex-5 complex. Mattera R, Arighi CN, Lodge R, Zerial M, Bonifacino JS. EMBO J. 2003 Jan 2;22(1):78-88. doi: 10.1093/emboj/cdg015. 10.1093/emboj/cdg015 PubMed 12505986
Map uploaded by the depositor.
