E228Q Vps4A-HA
(Plasmid
#200087)
-
Purpose3x HA-VPS4A with E228Q dominant negative mutation in Dox-inducible pInducer20 vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 200087 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepINDUCER20
- Backbone size w/o insert (bp) 11794
- Total vector size (bp) 11611
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVPS4A
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3701
-
MutationE228Q
-
GenBank IDNM_013245.3
-
Entrez GeneVPS4A (a.k.a. CIMDAG, SKD1, SKD1A, SKD2, VPS4, VPS4-1)
- Promoter CMV
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GGGCGGAGAAACTTAAGGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
E228Q Vps4A-HA was a gift from Jason MacGurn (Addgene plasmid # 200087 ; http://n2t.net/addgene:200087 ; RRID:Addgene_200087) -
For your References section:
Lysosomal trafficking of the glucose transporter GLUT1 requires sequential regulation by TXNIP and ubiquitin. Qualls-Histed SJ, Nielsen CP, MacGurn JA. iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106150 PubMed 36890792