Skip to main content

pegRNA_LMNA-1
(Plasmid #199273)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 199273 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pU6
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LMNA 1824CtoT pegRNA
  • gRNA/shRNA sequence
    GGCTCAGGAGCCCAGGTGGG

Cloning Information

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone is from Addgene Plasmid #132777.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pegRNA_LMNA-1 was a gift from Ting Zhou (Addgene plasmid # 199273 ; http://n2t.net/addgene:199273 ; RRID:Addgene_199273)
  • For your References section:

    Transient inhibition of p53 enhances prime editing and cytosine base-editing efficiencies in human pluripotent stem cells. Li M, Zhong A, Wu Y, Sidharta M, Beaury M, Zhao X, Studer L, Zhou T. Nat Commun. 2022 Oct 27;13(1):6354. doi: 10.1038/s41467-022-34045-7. 10.1038/s41467-022-34045-7 PubMed 36302757