pegRNA_LMNA_CR-2-5
(Plasmid
#199275)
-
PurposepegRNA used to correct LMNA (c.1824C > T) mutation
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 199275-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 199275-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepU6
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLMNA 1824TtoC pegRNA
-
gRNA/shRNA sequenceGCCGACAAGGCATCTGCCAG
-
SpeciesSynthetic
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer LKO.1 5'
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone is from Addgene Plasmid #132777.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 199275-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 199275-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pegRNA_LMNA_CR-2-5 was a gift from Ting Zhou (Addgene plasmid # 199275 ; http://n2t.net/addgene:199275 ; RRID:Addgene_199275) -
For your References section:
Transient inhibition of p53 enhances prime editing and cytosine base-editing efficiencies in human pluripotent stem cells. Li M, Zhong A, Wu Y, Sidharta M, Beaury M, Zhao X, Studer L, Zhou T. Nat Commun. 2022 Oct 27;13(1):6354. doi: 10.1038/s41467-022-34045-7. 10.1038/s41467-022-34045-7 PubMed 36302757