AAVS1-idCas9-KRAB-Hygro donor
(Plasmid
#199621)
-
PurposeDonor vector for genomic targeting of a Tetracycline-inducible dCas9-KRAB cassette to the human AAVS1/PPP1R12C locus
-
Depositing Lab
-
Depositing OrganizationMemorial Sloan-Kettering Cancer Center
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 199621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 199621-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 199621-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneAAVS1-donor
- Total vector size (bp) 11249
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAAVS1-idCas9-KRAB-Hygro
-
Insert Size (bp)8384
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (unknown if destroyed)
- 3′ cloning site PacI (unknown if destroyed)
- 5′ sequencing primer GTTCTGGCAAGGAGAGAGATG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byJulian Pulecio
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
dCas9-KRAB was cloned from AAVS1-idCas9-KRAB-Blast donor and inserted into Hygro resistant AAVS1 backbone.
Please visit https://www.biorxiv.org/content/10.1101/2023.03.07.531569v1 for bioRxiv preprint.
DNA (Catalog # 199621-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 199621-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAVS1-idCas9-KRAB-Hygro donor was a gift from Danwei Huangfu (Addgene plasmid # 199621 ; http://n2t.net/addgene:199621 ; RRID:Addgene_199621) -
For your References section:
Dynamic network-guided CRISPRi screen identifies CTCF-loop-constrained nonlinear enhancer gene regulatory activity during cell state transitions. Luo R, Yan J, Oh JW, Xi W, Shigaki D, Wong W, Cho HS, Murphy D, Cutler R, Rosen BP, Pulecio J, Yang D, Glenn RA, Chen T, Li QV, Vierbuchen T, Sidoli S, Apostolou E, Huangfu D, Beer MA. Nat Genet. 2023 Aug;55(8):1336-1346. doi: 10.1038/s41588-023-01450-7. Epub 2023 Jul 24. 10.1038/s41588-023-01450-7 PubMed 37488417
Map uploaded by the depositor.
