pCMV-eGFP-mPlum-HA
(Plasmid
#200009)
-
PurposeDonor vector with double fluorescence system for targeted integration using CRISPR/Cas9. Expresses 5´HA--eGFP&PuroR--3´HA--mPlum. Distinguish targeted from random integration by fluorescence.
-
Depositing Lab
-
Depositing OrganizationUniversitaet Bielefeld
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200009 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 200009-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 200009-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-Green Renilla Luc
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 5000
- Total vector size (bp) 7185
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameeGFP, mPlum
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer Pause_for CTAGCAAAATAGGCTGTCCC
- 3′ sequencing primer AmpR_rev GGTGCCTCACTGATTAAGCATTGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 200009-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 200009-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-eGFP-mPlum-HA was a gift from Thomas Noll (Addgene plasmid # 200009 ; http://n2t.net/addgene:200009 ; RRID:Addgene_200009) -
For your References section:
Enhancing stability of recombinant CHO cells by CRISPR/Cas9-mediated site-specific integration into regions with distinct histone modifications. Hertel O, Neuss A, Busche T, Brandt D, Kalinowski J, Bahnemann J, Noll T. Front Bioeng Biotechnol. 2022 Oct 13;10:1010719. doi: 10.3389/fbioe.2022.1010719. eCollection 2022. 10.3389/fbioe.2022.1010719 PubMed 36312557
Map uploaded by the depositor.
