TXNIP-py-FLAG
(Plasmid #200092)

• Purpose: TXNIP py motif mutant with C-terminal 3xFLAG tag in pQCXIP vector
• Depositing Lab: Jason MacGurn
• Publication: Qualls-Histed et al iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17.

Backbone

• Vector backbone: pQCXIP
• Backbone manufacturer: ClonTech
• Backbone size w/o insert (bp): 7265
• Total vector size (bp): 8420
• Modifications to backbone: C-terminal 3xFLAG tag added
• Vector type: Mammalian Expression, Retroviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TXNIP
• Species: H. sapiens (human)
• Insert Size (bp): 1174
• Mutation: py motifs mutated (aa331-334 and 375-378)
• GenBank ID: NM_001313972.2
• Entrez Gene: TXNIP (a.k.a. ARRDC6, EST01027, HHCPA78, THIF, VDUP1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • 3xFLAG (C terminal on backbone)
  • 3xFLAG (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (not destroyed)
• 3′ cloning site: PacI (destroyed during cloning)
• 5′ sequencing primer: AACCGTCAGATCGCCTGGAG

Resource Information

• Supplemental Documents:
  • TXNIP-py-FLAG.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry