11K-cyto-->R GLUT1-GFP
(Plasmid
#200096)
-
Purposehuman GLUT1 with K-->R mutations for all 11 cytosolic lysines and a C-terminal GFP tag in pQCXIP vector
-
Depositing Lab
-
Depositing OrganizationVanderbilt University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200096 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerClonTech
- Backbone size w/o insert (bp) 7400
- Total vector size (bp) 9409
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGLUT1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2245
-
MutationK-->R mutations of amino acids 6, 7, 225, 229, 230, 245, 255, 256, 451, 456, 477
-
GenBank IDNM_006516.4
-
Entrez GeneSLC2A1 (a.k.a. CSE, DYT17, DYT18, DYT9, EIG12, GLUT, GLUT-1, GLUT1, GLUT1DS, HTLVR, PED, SDCHCN)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site AleI (not destroyed)
- 5′ sequencing primer AACCGTCAGATCGCCTGGAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
11K-cyto-->R GLUT1-GFP was a gift from Jason MacGurn (Addgene plasmid # 200096 ; http://n2t.net/addgene:200096 ; RRID:Addgene_200096) -
For your References section:
Lysosomal trafficking of the glucose transporter GLUT1 requires sequential regulation by TXNIP and ubiquitin. Qualls-Histed SJ, Nielsen CP, MacGurn JA. iScience. 2023 Feb 6;26(3):106150. doi: 10.1016/j.isci.2023.106150. eCollection 2023 Mar 17. 10.1016/j.isci.2023.106150 PubMed 36890792