Skip to main content

2333_Cas9-CtIP-dnRNF168
(Plasmid #200254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200254 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 200254-D50 50 μg of DNA in Tris buffer $495
DNA 200254-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pPIX
  • Backbone size w/o insert (bp) 3197
  • Total vector size (bp) 7214
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9-CtIP-dnRNF168
  • Species
    H. sapiens (human); Streptococcus pyogenes
  • Insert Size (bp)
    8661
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ATCCACTTTGCCTTTCTCTCCACAGG
  • 3′ sequencing primer cctcgactgtgccttcta
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    2333_Cas9-CtIP-dnRNF168 was a gift from Claudio Mussolino (Addgene plasmid # 200254 ; http://n2t.net/addgene:200254 ; RRID:Addgene_200254)
  • For your References section:

    A novel Cas9 fusion protein promotes targeted genome editing with reduced mutational burden in primary human cells. Carusillo A, Haider S, Schafer R, Rhiel M, Turk D, Chmielewski KO, Klermund J, Mosti L, Andrieux G, Schafer R, Cornu TI, Cathomen T, Mussolino C. Nucleic Acids Res. 2023 May 22;51(9):4660-4673. doi: 10.1093/nar/gkad255. 10.1093/nar/gkad255 PubMed 37070192