pDV05.1_pEF1a-iRFP720_frameshifted
(Plasmid
#200408)
-
PurposeExpresses a mutant iRFP720 mRNA constitutively in mammalian cells. A frameshift deletion in the ORF (compared to pDV05.0) prevents the correct translation of the fluorescent protein
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200408 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 200408-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 200408-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backboneCustom
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiRFP720 (frameshift mutant)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 200408-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 200408-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDV05.1_pEF1a-iRFP720_frameshifted was a gift from James Collins (Addgene plasmid # 200408 ; http://n2t.net/addgene:200408 ; RRID:Addgene_200408) -
For your References section:
Autocatalytic base editing for RNA-responsive translational control. Gayet RV, Ilia K, Razavi S, Tippens ND, Lalwani MA, Zhang K, Chen JX, Chen JC, Vargas-Asencio J, Collins JJ. Nat Commun. 2023 Mar 11;14(1):1339. doi: 10.1038/s41467-023-36851-z. 10.1038/s41467-023-36851-z PubMed 36906659